Abracris flavolineata

(De Geer, 1773) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Orthoptera/Acrididae/Abracris

At a glance

Occurrence records8 381

Data sources10

Biological traits0

DNA specimens58

eDNA detections54

Sources10 archives

Databases and archives Abracris flavolineata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility8 381 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI54 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics58 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF8 381 records

Environmental DNA1 datasets · 0 countries54 detections

DNA & barcodingBOLD58 specimens

Genome at a glanceGoaT · TreeOfSex2n = 24

01Narrative

Abracris flavolineata is a species of short-horned grasshopper in the family Acrididae, found in southern North America, Central America, and South America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding58 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abracris flavolineata has left across the world's sequence archives.

At a glance

DNA specimens58

BINs1

Marker genes1

eDNA detections54

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P618 bp consensus57 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

30Cmostly conserved

130Gmostly conserved

160Amostly conserved

185Tmostly conserved

277Cmostly conserved

346Tmostly conserved

365Tmostly conserved

512Tmostly conserved

521Tmostly conserved

604Cmostly conserved

AAATAATATAAGATTCTGATTATTACCACCATCATTAACACTTCTTCTAATATCTTCTATAGTGGATGGAGGAGCAGGTACAGGATGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.59%

Haplotypes19

BIN1

Most divergent pair4.0%

Other

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phaeocatantops sulphureussame family12.3%Coryphosima stenopterasame family12.4%Dociostaurus minutussame family12.9%Sinipta hectorisperoniisame family13.1%Pardalophora phoenicopterasame family13.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Abracris flavolineata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 24 n = 12

Chromosome records24–242n range24median24mode4records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 244×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Polyneoptera Karyotype Database +1

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Polyneoptera Karyotype Database — ↗

TreeOfSex · invert — Mesa, A., Ferreira, A., & Carbonell, C. S. (1982). Cariologia de los acridoideos neotropicales: estado actual de su conocimiento y nuevas contribuciones. Ann Soc Ent Fr, 18, 507-526. ↗

2n 233×GoaT · Animal Chromosome Counts Database · GoaT · Tree of Sex Database · GoaT · Polyneoptera Karyotype Database

GoaT · Animal Chromosome Counts Database — ↗

GoaT · Tree of Sex Database — ↗

GoaT · Polyneoptera Karyotype Database — ↗

08Occurrence & distribution

Record type8 381 records

Wild obs. + sensor6 559

Museum / vouchered1 822

Range

Area of Occupancy AOO14 800 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 2 806≤1 km 1 476≤10 km 674>10 km 231

5 187 georeferenced · 1 372 without coordinates

Open the mapobservation + sensor6 559

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy36% within 1 km

≤100 m 17≤1 km 259≤10 km 415>10 km 72

763 georeferenced · 1 059 without coordinates

Open the institutions mapphysical evidence1 822

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	932
Museu Paraense Emílio Goeldilocation not on record	45
PUC-RSlocation not on record	43
Mexico City, MX	18
Champaign, US	5
University of Alabamalocation not on record	4
Colorado State Universitylocation not on record	3
Paris, FR	1
•, MNHNlocation not on record	1
Stockholm, SE	1
Alcaldía Municipal de Garzón en Huilalocation not on record	1
Bonn, DE	1

12 institutions · 1 055 of 1 822 vouchered records shown · 767 without an institution code

09Environmental DNA54 detections

Where the DNA of Abracris flavolineata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found54

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 54 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abracris flavolineata

At a glance

Sources10 archives

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type8 381 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type8 381 records