Abra nitida
(O.F.Müller, 1776) · speciesAt a glance
Occurrence records65 853
Data sources7
Biological traits5
DNA specimens26
eDNA detections1 196
Sources7 archives
Databases and archives Abra nitida's data was compiled from.
WikipediaWikimedia Foundation3 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility39 773 records↗
OBISOcean Biodiversity Information System26 080 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI1 196 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
Open Tree of LifeOpenTreephylogeny backbone↗On this page5 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements1 literature sources5 traits
Occurrence & distributionGBIF · OBIS65 853 records
Environmental DNA7 datasets · 5 countries1 196 detections
DNA & barcodingBOLD26 specimens
01Narrative
Die Glänzende Pfeffermuschel (Abra nitida) ist eine Muschelart aus der Familie der Pfeffermuscheln (Semelidae). Sie kommt auch in der Nordsee vor.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesSeaLifeBase
Life cycle & reproduction1
Max. longevity24 months
Habitat & environment2
Habitat saltwateryes
Habitat zonebenthic
Other traits2
Depth max4 400 m
Depth min24 m
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abra nitida has left across the world's sequence archives.
At a glance
DNA specimens26
BINs2
Marker genes2
eDNA detections1 196
Countries5
The DNA barcodethe species' typical barcode, built from every sequenced specimen
COI-5P655 bp consensus10 specimens
ACGT
▸ drag or hover over the strip to read any position — letter and how much it varies
Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.
Where individuals differ — all 65 variable positions, in barcode order
25Gmostly conserved
43Tmostly conserved
55Tmostly conserved
61Amostly conserved
64Amostly conserved
82Tmostly conserved
88Cmostly conserved
97Cmostly conserved
100Tmostly conserved
130Tmostly conserved
133Tmostly conserved
136Amostly conserved
145Gmostly conserved
157Amostly conserved
160Tmostly conserved
163Gmostly conserved
187Amostly conserved
193Gmostly conserved
196Cmostly conserved
199Tmostly conserved
202Cmostly conserved
211Gmostly conserved
238Tmostly conserved
262Tmostly conserved
263Cmostly conserved
265Gmostly conserved
271Cmostly conserved
295Amostly conserved
316Tmostly conserved
319Tmostly conserved
332Cmostly conserved
356Cmostly conserved
364Tmostly conserved
373Tmostly conserved
382Gmostly conserved
391Cmostly conserved
392Cmostly conserved
412Tmostly conserved
415Gmostly conserved
418Amostly conserved
421Cmostly conserved
424Cmostly conserved
430Tmostly conserved
460Cmostly conserved
478Cmostly conserved
481Cmostly conserved
490Gmostly conserved
491Amostly conserved
493Tmostly conserved
499Gmostly conserved
520Cmostly conserved
529Cmostly conserved
530Cmostly conserved
538Tmostly conserved
539Gmostly conserved
547Gvariable
568Gmostly conserved
583Gmostly conserved
592Tmostly conserved
622Gmostly conserved
625Cmostly conserved
631Tmostly conserved
634Amostly conserved
640Cmostly conserved
643Cmostly conserved
AAGTTTATATTTTGTTTTAGGTTTGTGGTCTGGGCTTGTGGGTTTAGTTTATAGTATTATAATACGTACAGAGCTTATACATCCGGGCGC …
Variant network
Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.
Diversity (π)2.1%
Haplotypes3
BINs2
Most divergent pair9.9%
EuropeOther
Closest relatives by DNA barcode
The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P18S-5P
animal barcoderibosomal
08Occurrence & distribution
Record type65 853 records
Wild obs. + sensor23 116
Museum / vouchered26 688
Fossil18
Other16 031
Origin
Native5
Range
Area of Occupancy AOO32 604 km²
Depth
0–200 m sunlit13 542
200–1000 m twilight2 064
1–4 km midnight2
>4 km abyssal1
median 36.2 m · max 4 060 m · 15 609 records with depth
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy99% within 1 km
≤100 m 19 889≤1 km 270≤10 km 94>10 km 18
20 271 georeferenced · 2 845 without coordinates
Open the mapobservation + sensor23 116
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy92% within 1 km
≤100 m 1 222≤1 km 1 527≤10 km 219>10 km 19
2 987 georeferenced · 23 701 without coordinates
Open the institutions mapphysical evidence26 688
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions12 of 50 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| 730location not on record | 2 317 |
| CEFASlocation not on record | 2 021 |
| NTNU-VMlocation not on record | 1 572 |
| RWSlocation not on record | 978 |
| Stockholm, SE | 774 |
| Bergen, NO | 552 |
| Gothenburg, SE | 426 |
| MZLUlocation not on record | 348 |
| DASSHlocation not on record | 322 |
| SLU Artdatabankenlocation not on record | 270 |
| Institut Francais pour l'Etude de la Merlocation not on record | 82 |
| Norwegian Institute of Marine Researchlocation not on record | 66 |
| Hellenic Centre of Marine Research; Institute for Oceanographylocation not on record | 57 |
| Frankfurt am Main | 48 |
| BioFokuslocation not on record | 38 |
| 486location not on record | 36 |
| PNHSlocation not on record | 32 |
| Plymouth Marine Laboratorylocation not on record | 29 |
| 630location not on record | 19 |
| Institute of Biology of the Southern Seas (IBSS), Ukrainelocation not on record | 18 |
| Citadel Hill, GB | 15 |
| Natural History Museum Rotterdamlocation not on record | 14 |
| Deutsches Zentrum fuer Marine Biodiversitaetsforschunglocation not on record | 13 |
| Observatoire Océanologique de Banyuls-Sur-Mer; Laboratoire d'Océanographie Biologiquelocation not on record | 12 |
| Biomorlocation not on record | 11 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 10 |
| Laboratoria di biologia marina di Triestelocation not on record | 10 |
| Paris, FR | 9 |
| Johanna Bergkvistlocation not on record | 7 |
| Santa Barbara Museum of Natural Historylocation not on record | 7 |
| Cambridge, US | 7 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 6 |
| UGentlocation not on record | 5 |
| Stockholm, SE | 5 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 4 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503)location not on record | 3 |
| Brussels, BE | 3 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507) Université de Liège Underwater research and oceanographic station (4501)location not on record | 2 |
| Station Biologique de Roscoff (EDMO:521)location not on record | 2 |
| Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Scienceslocation not on record | 1 |
| Philadelphia, US | 1 |
| South Kensington, GB | 1 |
| UKRSCESlocation not on record | 1 |
| RBINS-Scientific Heritagelocation not on record | 1 |
| University Museum of Bergen, Natural History Collectionslocation not on record | 1 |
| ARMS-MBONlocation not on record | 1 |
| Copenhagen, DK | 1 |
| CSIC-CEAB Centre for Advanced Studies of Blanes (1393) Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Université de Liège Underwater research and oceanographic station (4501)location not on record | 1 |
| Eco laboratory geochemistry Benthic Environments UMR 8222 (4503) Phaxas Expertise Of Marine Fauna (4507)location not on record | 1 |
| Laboratorio di Ecologia del Benthos | Benthos Ecology Laboratorylocation not on record | 1 |
50 institutions · 10 161 of 26 688 vouchered records shown · 5 284 without an institution code
09Environmental DNA1 196 detections
Where the DNA of Abra nitida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found1 196
Studies independent surveys7
Countries5
Verifiable raw sequence linked1 185
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 1 196 detections have coordinates
Open the map5 countries0
Sand and shellsSoft bottomSoft mudMarina; semi-industrial; 9.3 - Subtidal Loos…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median6.60 °C -11.2–11.4
Seasonal swing summer↔winter37.4 °C
Max temp (day)9.60 °C -8.80–15.5
Min temp (night)3.60 °C -13.3–8.80
Precipitation89.4 mm/mo 32.4–116
Air humidity62.0 % 60.8–69.7
Moisture balance29.6 mm/mo
Vapour deficit382 Pa 78.7–521
Wind speed4.30 m/s
Cloud cover51.2 % 43.3–61.0
CHELSA 1981–2010, ~9 km grid, at location & month of 1 195 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.