Aborichthys kempi — The Life Data

Animalia/Chordata/Cypriniformes/Nemacheilidae/Aborichthys

At a glance

Occurrence records4

Data sources6

Biological traits5

DNA specimens4

eDNA detections0

Sources6 archives

Databases and archives Aborichthys kempi's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 records↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources5 traits

Occurrence & distributionGBIF4 records

DNA & barcodingBOLD4 specimens

01Narrative

Aborichthys kempi is een straalvinnige vissensoort uit de familie van de bermpjes (Nemacheilidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1913 door Chaudhuri.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length8.1 cm

Habitat & environment2

Habitat freshwateryes

Habitat zonedemersal

Uses & economy1

Commercial importanceof no interest

Other traits1

Vulnerability10

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aborichthys kempi has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P529 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.54%

Haplotypes1

BIN1

Where individuals differ — all 5 variable positions, in barcode order

67Amostly conserved

282Cmostly conserved

352Amostly conserved

361Avariable

382Avariable

TGTTATAATTTTCTTTATAGTAATACCAATCCTTATTGGGGGATTCGGAAATTGACTAGTGCCTCTAATAATTGGAGCCCCTGACATGGC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aborichthys verticaudasame genus4.3%Enteromius pellegrinisame order15.2%Enteromius lineomaculatussame order15.8%Enteromius camptacanthussame order16.0%Enteromius unitaeniatussame order16.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

COI-5P

animal barcode

08Occurrence & distribution

Record type4 records

Wild obs. + sensor4

Range

Area of Occupancy AOO16 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 4

4 georeferenced

Open the mapobservation + sensor4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.