Abludomelita obtusata

(Montagu, 1813) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Malacostraca/Amphipoda/Melitidae/Abludomelita

At a glance

Occurrence records9 781

Data sources9

Biological traits6

DNA specimens16

eDNA detections31

Sources9 archives

Databases and archives Abludomelita obtusata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 017 records↗

OBISOcean Biodiversity Information System4 764 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI31 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics16 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS9 781 records

Environmental DNA2 datasets · 3 countries31 detections

DNA & barcodingBOLD16 specimens

01Narrative

Abludomelita obtusata is a brown colored species of amphipod crustacean. It may grow up to 9 mm long and lacks a rostrum. It lives in marine sediments of any grain size, but with a preference for a mud content of 10%–40%, around the coasts of the southern North Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length0.9 cm

Habitat & environment3

Habitat brackishyes

Habitat saltwateryes

Habitat zonebenthic

Other traits2

Depth max47 m

Depth min0 m

05DNA & barcoding16 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abludomelita obtusata has left across the world's sequence archives.

At a glance

DNA specimens16

BINs2

Marker genes1

eDNA detections31

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

9Tmostly conserved

15Cvariable

270Amostly conserved

462Cmostly conserved

468Tmostly conserved

532Cmostly conserved

588Cmostly conserved

ACTTTGTATTTATACTTTGGTATTTTTTCTGGTGTTATTGGTTCATCAATAAGTTTTATAATTCGGGCTCAACTTAGTTCGCCGTTTAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.56%

Haplotypes3

BIN1

Most divergent pair0.91%

OtherEurope

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type9 781 records

Wild obs. + sensor2 101

Museum / vouchered5 284

Other2 396

Range

Area of Occupancy AOO8 276 km²

Depth

0–200 m sunlit2 341

200–1000 m twilight26

1–4 km midnight0

>4 km abyssal0

median 22.2 m · max 427 m · 2 367 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy91% within 1 km

≤100 m 1 352≤1 km 68≤10 km 138

1 558 georeferenced · 543 without coordinates

Open the mapobservation + sensor2 101

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy76% within 1 km

≤100 m 94≤1 km 50≤10 km 34>10 km 11

189 georeferenced · 5 095 without coordinates

Open the institutions mapphysical evidence5 284

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	1 300
Research Institute for Agriculture, Fisheries and Food (ILVO)location not on record	354
RWSlocation not on record	242
Institut Francais pour l'Etude de la Merlocation not on record	190
Frankfurt am Main	108
486location not on record	74
DASSHlocation not on record	57
730location not on record	55
Gothenburg, SE	48
Auckland, NZ	31
Station Biologique de Roscoff (EDMO:521)location not on record	20
Stockholm, SE	19
630location not on record	12
UGentlocation not on record	10
Laboratoire d'Océanographie Biologique, Universite de Bordeaxlocation not on record	8
Biomorlocation not on record	7
SLU Artdatabankenlocation not on record	7
FEMlocation not on record	5
German Centre for Marine Biodiversity Researchlocation not on record	5
MZLUlocation not on record	4
PNHSlocation not on record	3
Museum für Naturkunde Berlin (Zoological Collections)location not on record	2
Citadel Hill, GB	2
WMR_IMARESlocation not on record	1
Zoologisches Museum Hamburglocation not on record	1
Paris, FR	1
IfAÖ Institut für Angewandte Ökosystemforschung GmbHlocation not on record	1
DIHOlocation not on record	1
The Atlantic reference Centrelocation not on record	1
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

31 institutions · 2 571 of 5 284 vouchered records shown · 174 without an institution code

09Environmental DNA31 detections

Where the DNA of Abludomelita obtusata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found31

Studies independent surveys2

Countries3

Verifiable raw sequence linked15

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 31 detections have coordinates

Open the map3 countries0

Sand and shell sandHard bottom

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.1 °C 13.1–18.2

Seasonal swing summer↔winter12.2 °C

Max temp (day)17.0 °C 14.4–20.2

Min temp (night)12.9 °C 11.9–16.1

Precipitation91.3 mm/mo 78.8–101

Air humidity63.0 % 62.5–63.9

Vapour deficit634 Pa 551–751

Cloud cover43.5 % 38.7–46.2

CHELSA 1981–2010, ~9 km grid, at location & month of 27 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abludomelita obtusata

At a glance

Sources9 archives

Size & morphology1

Habitat & environment3

Other traits2

At a glance

Record type9 781 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 31 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type9 781 records