Ablabys binotatus

(Peters, 1855) · species

image placeholder — illustration coming later

Animalia/Chordata/Scorpaeniformes/Tetrarogidae/Ablabys

At a glance

Occurrence records51

Data sources9

Biological traits4

DNA specimens15

eDNA detections14

Sources9 archives

Databases and archives Ablabys binotatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility28 records↗

OBISOcean Biodiversity Information System23 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI14 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics15 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS51 records

Environmental DNA1 datasets · 3 countries14 detections

DNA & barcodingBOLD15 specimens

01Narrative

Ablabys binotatus , the redskinfish, is a species of marine ray-finned fish, a waspfish belonging to the subfamily Tetraroginae of the family Scorpaenidae, the scorpionfishes and their relatives. This species is found in the Indian Ocean.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology1

Body length15 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthopelagic

Other traits1

Vulnerability10

05DNA & barcoding15 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ablabys binotatus has left across the world's sequence archives.

At a glance

DNA specimens15

BINs1

Marker genes1

eDNA detections14

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus13 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 7 variable positions, in barcode order

61Tvariable

142Cmostly conserved

217Amostly conserved

226Amostly conserved

319Tmostly conserved

352Tmostly conserved

622Cmostly conserved

CCTATATTTAGTATTTGGTGCTTGAGCTGCAATAGTAGGTACAGCCCTAAGTCTTCTTATTCGAGCAGAACTCTCCCAACCCGGTAGTCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.24%

Haplotypes4

BIN1

Most divergent pair0.46%

Africa

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ablabys taenianotussame genus9.6%Synanceia horridasame family14.9%Notesthes robustasame family15.5%Inimicus japonicussame family15.6%Cypselurus starksisame order15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type51 records

Wild obs. + sensor12

Museum / vouchered39

Range

Area of Occupancy AOO72 km²

Depth

0–200 m sunlit6

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 15 m · max 42 m · 6 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 5≤1 km 1

6 georeferenced · 6 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 1≤10 km 2>10 km 1

4 georeferenced · 35 without coordinates

Open the institutions mapphysical evidence39

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South African Institute for Aquatic Biodiversitylocation not on record	9
ICM-CSIClocation not on record	2
FishBaselocation not on record	2
Paris, FR	2
Institut Halieutique et des Sciences Marineslocation not on record	1
Museu Nacional de História Natural e da Ciêncialocation not on record	1

6 institutions · 17 of 39 vouchered records shown · 3 without an institution code

09Environmental DNA14 detections

Where the DNA of Ablabys binotatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found14

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 14 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 18.9–24.6

Seasonal swing summer↔winter5.10 °C

Max temp (day)22.7 °C 21.7–28.4

Min temp (night)20.7 °C 16.2–21.5

Precipitation95.0 mm/mo 34.3–95.0

Air humidity61.2 % 56.4–61.2

Vapour deficit1,009 Pa 937–1,270

Cloud cover26.2 % 13.1–26.2

CHELSA 1981–2010, ~9 km grid, at location & month of 14 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)