Ablabesmyia monilis

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Chironomidae/Ablabesmyia

At a glance

Occurrence records3 210

Data sources8

Biological traits0

DNA specimens1 117

eDNA detections6 228

Sources8 archives

Databases and archives Ablabesmyia monilis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 210 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 228 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 117 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome ~0.16 Gbp↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF3 210 records

Environmental DNA8 datasets · 16 countries6 228 detections

DNA & barcodingBOLD1 117 specimens

Genome at a glanceGoaT156 Mbp

01Narrative

Ablabesmyia monilis is a Palearctic species of Chironomidae described by Carl Linnaeus, in 1758.Bisby F.A., Roskov Y.R., Orrell T.M., Nicolson D., Paglinawan L.E., Bailly N., Kirk P.M., Bourgoin T., Baillargeon G., Ouvrard D. (red.) (13 september 2011). ”Species 2000 & ITIS Catalogue of Life: 2011 Annual Checklist.”. Species 2000: Reading, No sub-species mentioned in Catalogue of Life.Systema Dipterorum. Pape T. & Thompson F.C. (eds), It is found over all of EuropeFauna Europaea

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 117 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ablabesmyia monilis has left across the world's sequence archives.

At a glance

DNA specimens1 117

BINs12

Marker genes5

eDNA detections6 228

Countries16

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P654 bp consensus1 097 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

1Tmostly conserved

19Amostly conserved

70Amostly conserved

76Tmostly conserved

79Tmostly conserved

133Tmostly conserved

151Cmostly conserved

163Gmostly conserved

181Amostly conserved

209Cmostly conserved

226Amostly conserved

259Amostly conserved

265Gmostly conserved

268Tmostly conserved

289Amostly conserved

309Gvariable

310Cmostly conserved

316Amostly conserved

337Tmostly conserved

343Tmostly conserved

355Tmostly conserved

370Amostly conserved

382Tmostly conserved

409Cmostly conserved

418Tmostly conserved

452Gmostly conserved

470Amostly conserved

496Amostly conserved

497Cmostly conserved

517Tmostly conserved

536Tmostly conserved

559Tmostly conserved

562Amostly conserved

568Cmostly conserved

578Cmostly conserved

598Tmostly conserved

625Gmostly conserved

631Cmostly conserved

643Tmostly conserved

650Tmostly conserved

TTTATATTTTATTTTTGGAGCCTGATCAGGAATAGTAGGTACTTCCCTTAGTATTTTAATTCGAGCTGAATTAGGTCATCCAGGAGCTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 29 commonest of 106 variants.

Diversity (π)1.6%

Haplotypes106

BINs12

Most divergent pair15.4%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ablabesmyia prorashasame genus10.9%Potthastia gaediisame family11.6%Ablabesmyia peleensissame genus11.9%Telmatopelopia nemorumsame family12.1%Anopheles ovengensissame order12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P★COI-LIKE18S-3P28S

animal barcoderibosomalmarker

06Genome at a glanceGoaT

The complete instruction manual Ablabesmyia monilis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size156 480 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Ablabesmyia monilis0.16 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

08Occurrence & distribution

Record type3 210 records

Wild obs. + sensor2 511

Museum / vouchered691

Other8

Range

Area of Occupancy AOO6 740 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 2 374≤1 km 53≤10 km 17

2 444 georeferenced · 67 without coordinates

Open the mapobservation + sensor2 511

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy97% within 1 km

≤100 m 438≤1 km 24≤10 km 12

474 georeferenced · 217 without coordinates

Open the institutions mapphysical evidence691

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NTNU-VMlocation not on record	66
Helsinki, FI	34
University of Guelph, Centre for Biodiversity Genomicslocation not on record	30
Toronto, CA	8
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	4
Tromsø, NO	2
Wuzhou, CN	2
Rovaniemi, FI	2
Wellcome Sanger Institutelocation not on record	1
Sykelocation not on record	1
National Institute for Environmental Studieslocation not on record	1
Ugentlocation not on record	1

12 institutions · 152 of 691 vouchered records shown · 538 without an institution code

09Environmental DNA6 228 detections

Where the DNA of Ablabesmyia monilis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6 228

Studies independent surveys8

Countries16

Verifiable raw sequence linked2 372

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 228 detections have coordinates

Open the map16 countries0

5. Wetlands (inland)ForestHay meadow14. Artificial - Terrestrial|14.5 Urban AreasUrban1. Forest & Woodland | 1.1. Boreal Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.9 °C 10.0–18.1

Seasonal swing summer↔winter25.7 °C

Max temp (day)17.4 °C 12.5–23.0

Min temp (night)8.50 °C 5.80–15.4

Precipitation81.2 mm/mo 43.8–111

Air humidity58.7 % 55.4–62.7

Moisture balance-38.2 mm/mo -67.6–55.4

Vapour deficit650 Pa 449–907

Wind speed2.80 m/s 2.20–5.40

Cloud cover49.8 % 39.0–59.9

CHELSA 1981–2010, ~9 km grid, at location & month of 6 212 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ablabesmyia monilis

At a glance

Sources8 archives

At a glance

Genome sizehow big the whole instruction manual is

Record type3 210 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 12 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 210 records