Ablabesmyia annulata

(Say, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Chironomidae/Ablabesmyia

At a glance

Occurrence records389

Data sources6

Biological traits0

DNA specimens154

eDNA detections169

Sources6 archives

Databases and archives Ablabesmyia annulata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

GBIFGlobal Biodiversity Information Facility389 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI169 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics154 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF389 records

Environmental DNA1 datasets · 2 countries169 detections

DNA & barcodingBOLD154 specimens

01Narrative

Ablabesmyia annulata is a species of midge in the family Chironomidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding154 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ablabesmyia annulata has left across the world's sequence archives.

At a glance

DNA specimens154

BINs5

Marker genes2

eDNA detections169

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P645 bp consensus138 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 74% of positions are identical in every specimen.

Where individuals differ — all 168 variable positions, in barcode order

1Amostly conserved

2Cmostly conserved

3Tmostly conserved

4Tmostly conserved

6Amostly conserved

7Tmostly conserved

8Amostly conserved

13Amostly conserved

14Tmostly conserved

15Tmostly conserved

16Tmostly conserved

17Tmostly conserved

18Tmostly conserved

19Gmostly conserved

21Gmostly conserved

22Gmostly conserved

24Cmostly conserved

25Tmostly conserved

27Amostly conserved

28Tmostly conserved

29Cmostly conserved

30Tmostly conserved

32Gmostly conserved

33Amostly conserved

34Amostly conserved

35Tmostly conserved

36Amostly conserved

37Gmostly conserved

38Tmostly conserved

39Tmostly conserved

40Gmostly conserved

41Gmostly conserved

42Tmostly conserved

43Amostly conserved

44Cmostly conserved

45Amostly conserved

46Tmostly conserved

47Cmostly conserved

48Cmostly conserved

49Cmostly conserved

51Tmostly conserved

52Amostly conserved

53Gmostly conserved

54Tmostly conserved

57Cmostly conserved

58Tmostly conserved

59Tmostly conserved

61Amostly conserved

62Tmostly conserved

63Tmostly conserved

64Cmostly conserved

65Gmostly conserved

67Gmostly conserved

68Cmostly conserved

69Amostly conserved

71Amostly conserved

72Amostly conserved

73Cmostly conserved

74Tmostly conserved

75Amostly conserved

76Gmostly conserved

77Gmostly conserved

78Tmostly conserved

79Cmostly conserved

80Amostly conserved

81Cmostly conserved

82Cmostly conserved

84Amostly conserved

90Cmostly conserved

91Cmostly conserved

93Gmostly conserved

102Tmostly conserved

129Amostly conserved

132Tmostly conserved

156Cmostly conserved

183Amostly conserved

201Amostly conserved

204Cmostly conserved

211Cmostly conserved

219Cmostly conserved

231Amostly conserved

262Cmostly conserved

265Tmostly conserved

267Gmostly conserved

270Cmostly conserved

273Tmostly conserved

276Tmostly conserved

282Cmostly conserved

288Tmostly conserved

300Tmostly conserved

321Gmostly conserved

327Amostly conserved

333Amostly conserved

339Tvariable

345Tmostly conserved

346Tmostly conserved

349Gmostly conserved

351Cmostly conserved

363Tmostly conserved

369Amostly conserved

372Amostly conserved

375Amostly conserved

381Tmostly conserved

390Tmostly conserved

396Cmostly conserved

399Amostly conserved

402Tmostly conserved

405Cmostly conserved

411Tmostly conserved

420Gmostly conserved

423Amostly conserved

432Gmostly conserved

435Tmostly conserved

462Cmostly conserved

468Cmostly conserved

473Cmostly conserved

483Tmostly conserved

507Tmostly conserved

513Amostly conserved

517Amostly conserved

+48 more variable positions not shown

ACTTTATATTTTATTTTTGGGGCCTGATCTGGAATAGTTGGTACATCCCTTAGTATCTTAATTCGAGCAGAACTAGGTCACCCAGGAGCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)6.0%

Haplotypes12

BINs5

Most divergent pair18.8%

N.AmericaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ablabesmyia asperasame genus9.2%Ablabesmyia prorashasame genus10.2%Arctopelopia melanosomasame family11.7%Rachispoda frostisame order12.1%Arctopelopia barbitarsissame family12.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type389 records

Wild obs. + sensor195

Museum / vouchered191

Other3

Range

Area of Occupancy AOO688 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 104≤1 km 18≤10 km 6>10 km 24

152 georeferenced · 43 without coordinates

Open the mapobservation + sensor195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy79% within 1 km

≤100 m 15>10 km 4

19 georeferenced · 172 without coordinates

Open the institutions mapphysical evidence191

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Guelph, Centre for Biodiversity Genomicslocation not on record	86
Tempe, US	9
Wuzhou, CN	4
Champaign, US	3
Environmental Protection Agency, Office of Research and Development, Duluth, MNlocation not on record	1

5 institutions · 103 of 191 vouchered records shown · 88 without an institution code

09Environmental DNA169 detections

Where the DNA of Ablabesmyia annulata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found169

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 169 detections have coordinates

Open the map2 countries0

Mixed habitatGrasslandThe Dunes beach1. Forest & WoodlandForest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.7 °C 3.80–21.7

Seasonal swing summer↔winter27.7 °C

Max temp (day)24.2 °C 8.70–24.5

Min temp (night)19.9 °C 1.20–19.9

Precipitation94.8 mm/mo 74.7–94.8

Air humidity58.0 % 58.0–61.1

Moisture balance-97.2 mm/mo -97.2–37.0

Vapour deficit1,086 Pa 313–1,086

Wind speed6.10 m/s 3.80–6.10

Cloud cover39.2 % 36.7–60.6

CHELSA 1981–2010, ~9 km grid, at location & month of 163 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)