Abietinaria abietina

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Cnidaria/Hydrozoa/Leptothecata/Sertulariidae/Abietinaria

At a glance

Occurrence records13 748

Data sources7

Biological traits4

DNA specimens13

eDNA detections4

Sources7 archives

Databases and archives Abietinaria abietina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 867 records↗

OBISOcean Biodiversity Information System7 881 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics13 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS13 748 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD13 specimens

01Narrative

Het zeedennetje is een hydroïdpoliep uit de familie Sertulariidae. De wetenschappelijke naam van de soort werd als Sertularia abietina in 1758 gepubliceerd door Carl Linnaeus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max2 440 m

Depth min5 m

05DNA & barcoding13 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abietinaria abietina has left across the world's sequence archives.

At a glance

DNA specimens13

BINs1

Marker genes3

eDNA detections4

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 1 variable positions, in barcode order

523Avariable

AACTTTATATATTGTATTTGGAGCTTTTTCAGGTATGATTGGTACAGCATTAAGTATGCTAATAAGATTAGAATTAGCAGGACCAGGACC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abietinaria variabilissame genus8.7%Sertularia cupressinasame family9.9%Sertularia argenteasame family10.2%Ptychogena hyperboreasame order13.7%Sertularella rugosasame order13.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16S18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type13 748 records

Wild obs. + sensor7 071

Museum / vouchered5 052

Other1 625

Range

Area of Occupancy AOO12 064 km²

Depth

0–200 m sunlit5 036

200–1000 m twilight8

1–4 km midnight5

>4 km abyssal0

median 30.2 m · max 2 542 m · 5 049 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 3 691≤1 km 97≤10 km 147>10 km 1

3 936 georeferenced · 3 135 without coordinates

Open the mapobservation + sensor7 071

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 77≤1 km 118≤10 km 15>10 km 25

235 georeferenced · 4 817 without coordinates

Open the institutions mapphysical evidence5 052

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 34 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	791
Gothenburg, SE	67
Frankfurt am Main	62
Copenhagen, DK	54
DASSHlocation not on record	42
Brussels, BE	34
RBINS-Scientific Heritagelocation not on record	30
Washington, US	29
Stockholm, SE	29
South Kensington, GB	25
Zoological Museum, Moscow Lomonosov State Universitylocation not on record	23
RWSlocation not on record	15
Toronto, CA	12
Norwegian Institute of Marine Researchlocation not on record	12
Natural History Museum Rotterdamlocation not on record	11
CASlocation not on record	10
PNHSlocation not on record	10
730location not on record	9
Tromsø, NO	8
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	7
Santa Barbara Museum of Natural Historylocation not on record	5
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	5
MZLUlocation not on record	5
Tilburg, NL	4
Instytut Oceanologii Polskiej Akademii Nauklocation not on record	4
NTNU-VMlocation not on record	3
Institut Francais pour l'Etude de la Merlocation not on record	2
SLU Artdatabankenlocation not on record	2
UGentlocation not on record	1
	1
Florida Museum of Natural Historylocation not on record	1
Victoria, CA	1
Royal British Columbia Museumlocation not on record	1
Goteborg Natural History Museumlocation not on record	1

34 institutions · 1 316 of 5 052 vouchered records shown · 14 without an institution code

09Environmental DNA4 detections

Where the DNA of Abietinaria abietina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

Rocky bottom

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 10.7–15.6

Seasonal swing summer↔winter16.2 °C

Max temp (day)12.1 °C 12.1–16.6

Min temp (night)9.00 °C 9.00–14.5

Precipitation54.6 mm/mo 54.6–76.4

Air humidity58.3 % 58.3–61.4

Vapour deficit535 Pa 535–689

Cloud cover40.8 % 40.8–44.2

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abietinaria abietina

At a glance

Sources7 archives

Habitat & environment2

Other traits2

At a glance

Record type13 748 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 34 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type13 748 records