Abax ovalis

(Duftschmid, 1812) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Carabidae/Abax

At a glance

Occurrence records10 696

Data sources7

Biological traits0

DNA specimens43

eDNA detections39

Sources7 archives

Databases and archives Abax ovalis's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 696 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics43 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF10 696 records

Environmental DNA1 datasets · 7 countries39 detections

DNA & barcodingBOLD43 specimens

01Narrative

Der Ovale Breitkäfer (Abax ovalis) ist ein Käfer aus der Familie der Laufkäfer (Carabidae).

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding43 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abax ovalis has left across the world's sequence archives.

At a glance

DNA specimens43

BINs1

Marker genes2

eDNA detections39

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus38 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 5 variable positions, in barcode order

79Amostly conserved

379Amostly conserved

433Amostly conserved

559Amostly conserved

586Tmostly conserved

AACACTATATTTTATTTTTGGTACATGATCAGGAATAGTAGGAACATCTTTAAGAATATTAATTCGAGCTGAATTAGGAAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.27%

Haplotypes6

BIN1

Most divergent pair1.4%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abax parallelepipedussame genus8.7%Abax beckenhauptiisame genus9.0%Abax parallelussame genus9.6%Abax carinatussame genus10.8%Patrobus leconteisame family11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P

animal barcode

08Occurrence & distribution

Record type10 696 records

Wild obs. + sensor7 847

Museum / vouchered2 710

Cultivated / captive1

Other138

Origin

Native3 430

Range

Area of Occupancy AOO5 960 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy9% within 1 km

≤100 m 357≤1 km 274≤10 km 6 074>10 km 67

6 772 georeferenced · 1 075 without coordinates

Open the mapobservation + sensor7 847

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤100 m 31≤1 km 104≤10 km 2 491>10 km 20

2 646 georeferenced · 64 without coordinates

Open the institutions mapphysical evidence2 710

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	141
Musee d'Histoire Naturallelocation not on record	127
Geneva, CH	105
Dhaka, BD	98
Naturmuseum Solothurnlocation not on record	80
Paro, BT	55
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	53
Provincia di Livornolocation not on record	50
Frauenfeld, CH	47
Salzburg, AT	46
Bern, CH	45
Natural History Museum Rotterdamlocation not on record	35
NMOKlocation not on record	24
Leuphanalocation not on record	19
Adam Mickiewicz University in Poznańlocation not on record	12
Forschungsinstitut für biologischen Landbau Frick \| Research Institute of Organic Agriculture Fricklocation not on record	11
EGBlocation not on record	10
ZIBElocation not on record	10
ZSMlocation not on record	9
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	8
Helsinki, FI	7
Zürich, CH	6
NTNU-VMlocation not on record	5
Uniwersytet Wrocławskilocation not on record	4
Winterthur, CH	4
Universität Zürich, Naturhistorisches Museumlocation not on record	2
SFRAlocation not on record	2
HAFLlocation not on record	2
EIBElocation not on record	2
IZFRlocation not on record	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Ugentlocation not on record	1

32 institutions · 1 024 of 2 710 vouchered records shown · 1 686 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA39 detections

Where the DNA of Abax ovalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map7 countries0

spruce forestspruce forest, abandoned logging areaDinaric beech forestWaldrandABOLCAR-637Mischwald

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 5.80–18.1

Seasonal swing summer↔winter18.1 °C

Max temp (day)17.2 °C 9.40–22.6

Min temp (night)8.00 °C 1.90–13.2

Precipitation75.8 mm/mo 57.5–180

Air humidity61.5 % 58.1–64.1

Moisture balance9.10 mm/mo -44.9–119

Vapour deficit560 Pa 357–861

Wind speed3.00 m/s 1.50–4.50

Cloud cover38.3 % 34.5–45.5

CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abax ovalis

At a glance

Sources7 archives

At a glance

Record type10 696 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 32 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 696 records