Abantiades labyrinthicus

(Donovan, 1805) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Abantiades

At a glance

Occurrence records920

Data sources8

Biological traits0

DNA specimens22

eDNA detections23

Sources8 archives

Databases and archives Abantiades labyrinthicus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility920 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI23 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics22 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF920 records

Environmental DNA1 datasets · 1 countries23 detections

DNA & barcodingBOLD22 specimens

01Narrative

Abantiades labyrinthicus is a moth of the family Hepialidae. It is endemic to Australia, where it is found in the Australian Capital Territory, New South Wales, Queensland, Tasmania and Victoria.Australian Faunal Directory The wingspan is about 100 mm for males and 160 mm for females. The forewings are brown with two silver flashes. The larvae are subterranean and feed on the roots of various trees, possibly including Eucalyptus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding22 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abantiades labyrinthicus has left across the world's sequence archives.

At a glance

DNA specimens22

BINs2

Marker genes1

eDNA detections23

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 61 variable positions, in barcode order

22Tmostly conserved

31Amostly conserved

50Cmostly conserved

59Cmostly conserved

74Tmostly conserved

79Cmostly conserved

82Tmostly conserved

88Tmostly conserved

91Cmostly conserved

103Tmostly conserved

106Cmostly conserved

112Cmostly conserved

127Amostly conserved

136Cmostly conserved

160Avariable

181Amostly conserved

197Tmostly conserved

206Cmostly conserved

212Cmostly conserved

217Amostly conserved

220Cmostly conserved

223Tmostly conserved

229Amostly conserved

235Tmostly conserved

259Cmostly conserved

263Tmostly conserved

271Cmostly conserved

274Cmostly conserved

287Cmostly conserved

292Cmostly conserved

295Amostly conserved

313Cmostly conserved

337Cmostly conserved

346Amostly conserved

347Cmostly conserved

370Tmostly conserved

373Tmostly conserved

376Tmostly conserved

400Tmostly conserved

401Tmostly conserved

421Tmostly conserved

430Amostly conserved

442Cmostly conserved

463Cmostly conserved

474Amostly conserved

475Gmostly conserved

478Tmostly conserved

484Tmostly conserved

499Cmostly conserved

500Tmostly conserved

519Cmostly conserved

536Tmostly conserved

542Tmostly conserved

562Tmostly conserved

571Tmostly conserved

581Tmostly conserved

595Tvariable

596Tmostly conserved

601Cmostly conserved

625Tmostly conserved

628Gmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACATCACTAAGATTACTAATTCGAACTGAATTAGGCAATCCTGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.3%

Haplotypes10

BINs2

Most divergent pair9.3%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abantiades argentatasame genus7.2%Abantiades marcidussame genus7.3%Abantiades leucochitonsame genus7.4%Abantiades obscurasame genus7.6%Abantiades barnardisame genus7.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type920 records

Wild obs. + sensor773

Museum / vouchered147

Range

Area of Occupancy AOO1 360 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 292≤1 km 170≤10 km 94>10 km 29

585 georeferenced · 188 without coordinates

Open the mapobservation + sensor773

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy38% within 1 km

≤100 m 13≤1 km 3≤10 km 24>10 km 2

42 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence147

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museums Victorialocation not on record	97
Sydney, AU	16
Tasmanian Museum & Art Gallerylocation not on record	11
DPIlocation not on record	9
New Haven, US	6
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Australian National Insect Collectionlocation not on record	1

7 institutions · 142 of 147 vouchered records shown · 5 without an institution code

09Environmental DNA23 detections

Where the DNA of Abantiades labyrinthicus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found23

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 23 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.1 °C 14.8–20.0

Seasonal swing summer↔winter15.2 °C

Max temp (day)22.5 °C 18.5–25.0

Min temp (night)13.3 °C 11.0–15.6

Precipitation65.4 mm/mo 48.4–102

Air humidity56.2 % 55.1–62.3

Moisture balance-67.1 mm/mo -91.0–-6.20

Vapour deficit874 Pa 692–1,005

Wind speed2.70 m/s 2.00–3.50

Cloud cover19.9 % 17.6–26.8

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)