Abantiades hyalinatus

(Herrich-Schäffer, 1853) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Hepialidae/Abantiades

At a glance

Occurrence records591

Data sources7

Biological traits0

DNA specimens24

eDNA detections24

Sources7 archives

Databases and archives Abantiades hyalinatus's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility591 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF591 records

Environmental DNA1 datasets · 1 countries24 detections

DNA & barcodingBOLD24 specimens

01Narrative

Abantiades hyalinatus is a moth of the family Hepialidae. It is found in Australia, from southern Queensland to Tasmania. The wingspan is 10–12 cm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abantiades hyalinatus has left across the world's sequence archives.

At a glance

DNA specimens24

BINs1

Marker genes1

eDNA detections24

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus23 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 21 variable positions, in barcode order

10Cvariable

59Tmostly conserved

73Amostly conserved

85Amostly conserved

106Tmostly conserved

163Amostly conserved

181Amostly conserved

217Gmostly conserved

263Cmostly conserved

265Gmostly conserved

274Cmostly conserved

346Cmostly conserved

455Gmostly conserved

456Tmostly conserved

463Cmostly conserved

523Tmostly conserved

526Tmostly conserved

601Cmostly conserved

622Avariable

628Avariable

641Cmostly conserved

AACCTTATACTTTATTTTTGGTATTTGAGCTGGAATAGTTGGGACATCCCTAAGACTATTAATTCGAACTGAACTAGGTAATCCAGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.1%

Haplotypes5

BIN1

Most divergent pair2.6%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abantiades argentatasame genus6.2%Abantiades hydrographussame genus6.6%Abantiades leucochitonsame genus6.8%Abantiades obscurasame genus7.1%Abantiades zonatriticumsame genus7.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type591 records

Wild obs. + sensor360

Museum / vouchered231

Range

Area of Occupancy AOO956 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 119≤1 km 127≤10 km 37>10 km 10

293 georeferenced · 67 without coordinates

Open the mapobservation + sensor360

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy59% within 1 km

≤100 m 33≤1 km 9≤10 km 27>10 km 2

71 georeferenced · 160 without coordinates

Open the institutions mapphysical evidence231

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
QVMAGlocation not on record	87
Museums Victorialocation not on record	79
Tasmanian Museum & Art Gallerylocation not on record	52
Australian National Fish Collectionlocation not on record	7
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	2
Australian National Insect Collectionlocation not on record	1
Sydney, AU	1

7 institutions · 229 of 231 vouchered records shown · 2 without an institution code

09Environmental DNA24 detections

Where the DNA of Abantiades hyalinatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.6 °C 14.2–17.8

Seasonal swing summer↔winter8.50 °C

Max temp (day)20.0 °C 18.2–22.3

Min temp (night)11.4 °C 10.5–13.3

Precipitation50.2 mm/mo 44.3–87.4

Air humidity57.3 % 56.6–60.4

Moisture balance-64.0 mm/mo -95.5–-2.20

Vapour deficit761 Pa 686–853

Wind speed3.60 m/s 2.10–4.00

Cloud cover30.3 % 19.5–31.0

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)