Abalistes filamentosus

Matsuura & Yoshino, 2004 · species

image placeholder — illustration coming later

Animalia/Chordata/Tetraodontiformes/Balistidae/Abalistes

At a glance

Occurrence records635

Data sources9

Biological traits7

DNA specimens4

eDNA detections1

Sources9 archives

Databases and archives Abalistes filamentosus's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility325 records↗

OBISOcean Biodiversity Information System310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF · OBIS635 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD4 specimens

01Narrative

Abalistes filamentosus is a triggerfish of the genus Abalistes. It is found in the Indo-Pacific Ocean and in subtropical waters. It lives in the Pelagic-Neritic zone of the ocean between 61–180 meters deep. It is harmless to humans.Matsuura, K. & Yoshino, T. (2004): A new triggerfish of the genus Abalistes (Tetraodontiformes: Balistidae) from the western Pacific. Records of the Australian Museum, 56 (2): 189–194. [1]

No narrative description available for this taxon yet.

02Traits & measurements

SourcesFishBase

Size & morphology2

Body length32.5 cm

Body mass1 375 g

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic-neritic

Other traits3

Depth max180 m

Depth min61 m

Vulnerability29.65

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abalistes filamentosus has left across the world's sequence archives.

At a glance

DNA specimens4

BINs1

Marker genes1

eDNA detections1

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P652 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.15%

Haplotypes1

BIN1

Where individuals differ — all 2 variable positions, in barcode order

15Tmostly conserved

184Tmostly conserved

CCTTTACCTAATTTTTGGTGCTTGAGCTGGGATAGTAGGTACAGCCTTAAGCTTACTAATCCGAGCAGAATTAAGCCAACCCGGCGCTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abalistes stellarissame genus5.8%Abalistes stellatussame genus7.7%Balistoides conspicillumsame family11.7%Canthidermis sufflamensame family12.9%Balistes vetulasame family12.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type635 records

Wild obs. + sensor543

Museum / vouchered92

Range

Area of Occupancy AOO264 km²

Depth

0–200 m sunlit284

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 74 m · max 173 m · 284 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 541>10 km 2

543 georeferenced

Open the mapobservation + sensor543

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy94% within 1 km

≤100 m 15≤1 km 35≤10 km 3

53 georeferenced · 39 without coordinates

Open the institutions mapphysical evidence92

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	34
Kagoshima University Museumlocation not on record	11
Sydney, AU	2
Paris, FR	1
Natick, US	1
CSIRO, Australian National Fish Collectionlocation not on record	1

6 institutions · 50 of 92 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Abalistes filamentosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.9 °C 22.9–22.9

Seasonal swing summer↔winter5.60 °C

Max temp (day)23.6 °C

Min temp (night)22.1 °C

Precipitation12.8 mm/mo

Air humidity66.4 %

Vapour deficit934 Pa

Cloud cover19.7 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)