Abagrotis reedi

Buckett, 1969 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records288

Data sources7

Biological traits0

DNA specimens30

eDNA detections2

Sources7 archives

Databases and archives Abagrotis reedi's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility288 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics30 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF288 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD30 specimens

01Narrative

Abagrotis reedi is a moth of the family Noctuidae first described by John S. Buckett in 1969. It is found in North America, from California, east to Arizona, Colorado and Iowa into Canada where it is found in Manitoba, Saskatchewan, Alberta and British Columbia. The wingspan is 33–36 mm.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding30 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis reedi has left across the world's sequence archives.

At a glance

DNA specimens30

BINs1

Marker genes1

eDNA detections2

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus28 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

40Gvariable

52Avariable

85Cmostly conserved

118Tvariable

214Amostly conserved

287Tmostly conserved

454Amostly conserved

514Amostly conserved

520Amostly conserved

526Tmostly conserved

550Avariable

562Tmostly conserved

586Cmostly conserved

628Amostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTGGGAACCTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.98%

Haplotypes15

BIN1

Most divergent pair1.7%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis glennisame genus1.5%Abagrotis alampetasame genus1.7%Abagrotis orbissame genus1.7%Abagrotis pulchratasame genus2.0%Abagrotis vittifronssame genus2.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type288 records

Wild obs. + sensor15

Museum / vouchered273

Origin

Native1

Range

Area of Occupancy AOO500 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy40% within 1 km

≤100 m 2≤1 km 4≤10 km 4>10 km 5

15 georeferenced

Open the mapobservation + sensor15

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 19≤1 km 5≤10 km 56>10 km 15

95 georeferenced · 178 without coordinates

Open the institutions mapphysical evidence273

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	74
Oregon State Arthropod Collectionlocation not on record	30
Vernal, US	25
New Haven, US	24
San Diego, US	22
US	21
Colorado State Universitylocation not on record	17
ASUlocation not on record	13
Washington, US	8
Royal Saskatchewan Museumlocation not on record	8
Helsinki, FI	6
Mississippi State, US	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
East Lansing, US	1
Los Angeles, US	1
München, DE	1

16 institutions · 254 of 273 vouchered records shown · 19 without an institution code

09Environmental DNA2 detections

Where the DNA of Abagrotis reedi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)