Abagrotis mirabilis

Grote, 1879 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records208

Data sources6

Biological traits0

DNA specimens31

eDNA detections0

Sources6 archives

Databases and archives Abagrotis mirabilis's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility208 records↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF208 records

DNA & barcodingBOLD31 specimens

01Narrative

Abagrotis mirabilis is a moth of the family Noctuidae first described by Augustus Radcliffe Grote in 1879. It is found in western North America, from British Columbia south to California. The wingspan is about 35 mm. The larvae feed on Juniperus and Cedrus species.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis mirabilis has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes1

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus30 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

40Gmostly conserved

46Tmostly conserved

AACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTGGGAACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.10%

Haplotypes5

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Abagrotis striatasame genus1.5%Abagrotis henneisame genus1.5%Abagrotis alampetasame genus1.8%Abagrotis orbissame genus1.8%Abagrotis pulchratasame genus2.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type208 records

Wild obs. + sensor63

Museum / vouchered145

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 17≤1 km 12≤10 km 14>10 km 7

50 georeferenced · 13 without coordinates

Open the mapobservation + sensor63

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤100 m 6≤1 km 7≤10 km 38

51 georeferenced · 94 without coordinates

Open the institutions mapphysical evidence145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Alberta Museums (UAM)location not on record	40
Oregon State Arthropod Collectionlocation not on record	19
ASUlocation not on record	17
US	8
San Diego, US	7
Colorado State Universitylocation not on record	6
Denver, US	5
New Haven, US	4
East Lansing, US	4
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
Albuquerque, US	2
Awka, NG	2
Vernal, US	1
Mississippi State, US	1
WWUlocation not on record	1

15 institutions · 120 of 145 vouchered records shown · 25 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)