Abagrotis apposita

Grote, 1878 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Abagrotis

At a glance

Occurrence records183

Data sources7

Biological traits0

DNA specimens19

eDNA detections21

Sources7 archives

Databases and archives Abagrotis apposita's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility183 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF183 records

Environmental DNA1 datasets · 2 countries21 detections

DNA & barcodingBOLD19 specimens

01Narrative

Abagrotis apposita is a species of cutworm or dart moth in the family Noctuidae. It is found in North America. The MONA or Hodges number for Abagrotis apposita is 11037.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abagrotis apposita has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus19 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 9 variable positions, in barcode order

24Tmostly conserved

27Gmostly conserved

28Amostly conserved

29Gmostly conserved

30Cmostly conserved

31Tmostly conserved

32Gmostly conserved

34Amostly conserved

94Gmostly conserved

CACATTATATTTTATTTTTGGTATTTGAGCTGGAATAGTAGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.31%

Haplotypes5

BIN1

Most divergent pair0.46%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Spaelotis clandestinasame family3.5%Spaelotis ravidasame family3.5%Abagrotis forbesisame genus3.6%Spaelotis suecicasame family3.6%Spaelotis havilaesame family3.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type183 records

Wild obs. + sensor38

Museum / vouchered145

Range

Area of Occupancy AOO332 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 7≤1 km 7≤10 km 3>10 km 1

18 georeferenced · 20 without coordinates

Open the mapobservation + sensor38

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 4≤1 km 1≤10 km 1

6 georeferenced · 139 without coordinates

Open the institutions mapphysical evidence145

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Vernal, US	48
University of Alberta Museums (UAM)location not on record	40
Oregon State Arthropod Collectionlocation not on record	29
Colorado State Universitylocation not on record	6
National Institute of Biological Resourceslocation not on record	3
University of Guelph, Centre for Biodiversity Genomicslocation not on record	3
San Diego, US	2
WWUlocation not on record	2
New Haven, US	1

9 institutions · 134 of 145 vouchered records shown · 11 without an institution code

09Environmental DNA21 detections

Where the DNA of Abagrotis apposita was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.1 °C 15.5–21.2

Seasonal swing summer↔winter22.9 °C

Max temp (day)25.7 °C 20.2–28.8

Min temp (night)12.9 °C 9.60–14.0

Precipitation27.6 mm/mo 13.0–60.8

Air humidity49.1 % 45.0–60.2

Moisture balance-122 mm/mo -155–-52.0

Vapour deficit1,129 Pa 702–1,295

Wind speed2.20 m/s 1.70–3.80

Cloud cover31.0 % 14.9–39.8

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)