Abacoproeces saltuum

(L.Koch, 1872) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Arachnida/Araneae/Linyphiidae/Abacoproeces

At a glance

Occurrence records1 628

Data sources8

Biological traits11

DNA specimens8

eDNA detections6

Sources8 archives

Databases and archives Abacoproeces saltuum's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 628 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

World Spider Trait DBMasaryk University11 traits · 23 refs↗

World Spider CatalogNaturhist. Museum Bernworld catalog↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements23 literature sources11 traits

Occurrence & distributionGBIF1 628 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD8 specimens

01Narrative

Abacoproeces saltuum is a species of spider belonging to the family Linyphiidae. It is native to Europe to South Siberia.

No narrative description available for this taxon yet.

02Traits & measurements

Compiled from 23 sources

Birkhofer et al. 2017Entling et al. 2007Buchar & Růžička 2002Staręga et al. 2001SLU 2020Gajdoš et al. 2014Hyvärinen et al. 2019Henriksen & Hilmo 2015Komposch & Steinberger 1999Řezáč et al. 2015Blick et al. 2016Nährig et al. 2003Blick & Scheidler 2004Kielhorn 2017Finch 2004Martin 2012Buchholz et al. 2011Hiebsch & Tolke 1996Sacher & Platen 2004Lemke et al. 2013Liste France 2018Nentwig et al. 2018Cardoso et al. 2011

Morphometry1

Body length♀2.5·♂2.05 mm

Predation2

Hunting guildsheet web weavers

Simple hunting guild classificationcursorial

Ecology8

Ballooninglow

Light0.375 mm

Light 2partly shaded

Moisture 10.625 mm

Moisture 2semi-humid

Regional IUCN Red List categoryLeast Concern (lc)

Regional non-IUCN Red List categoryGenerally Threatened (G)

Stratumsurface

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Abacoproeces saltuum has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections6

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

13Tmostly conserved

14Gmostly conserved

68Avariable

163Tmostly conserved

205Cvariable

263Tvariable

343Cvariable

517Tvariable

577Avariable

592Gvariable

634Tmostly conserved

TACTTTGTATTTTGTTTTTGGGGCTTGGGCTGCTATAGTAGGGACAGCAATAAGAGTTTTAATTCGGATTGAGTTAGGTCAGACTGGTAG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.81%

Haplotypes3

BIN1

Most divergent pair1.2%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Hypselistes semiflavussame family13.6%Walckenaeria tricornissame family13.8%Hybauchenidium gibbosumsame family13.8%Semljicola angulatussame family14.3%Walckenaeria castaneasame family14.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 628 records

Wild obs. + sensor249

Museum / vouchered1 369

Cultivated / captive3

Other7

Range

Area of Occupancy AOO1 072 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 110≤1 km 93≤10 km 38

241 georeferenced · 8 without coordinates

Open the mapobservation + sensor249

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy75% within 1 km

≤100 m 53≤1 km 126≤10 km 43>10 km 17

239 georeferenced · 1 130 without coordinates

Open the institutions mapphysical evidence1 369

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Adam Mickiewicz University in Poznańlocation not on record	1 019
Helsinki, FI	132
Institute of Plant and Animal Ecology (IPAE), UB RASlocation not on record	42
Uniwersytet w Białymstokulocation not on record	37
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	28
SLU Artdatabankenlocation not on record	16
Ekaterinburg, RU	10
Provincia di Livornolocation not on record	9
Bonn, DE	6
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	5
Tartu, EE	5
NHMOlocation not on record	3
Rovaniemi, FI	2
University of Tokyo, Department of Zoologylocation not on record	2
Bavarian State Collection of Zoologylocation not on record	2
Tilburg, NL	2
SNSB-Zoologische Staatssammlung Münchenlocation not on record	2
Muzeum i Instytut Zoologii Polskiej Akademii Nauklocation not on record	2
BioFokuslocation not on record	1
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1
Akademia Pomorska w Słupskulocation not on record	1
Metsähallituslocation not on record	1
Institute of Plant and Animal Ecology (IPAE) UB RASlocation not on record	1
MZLUlocation not on record	1
Zoologisches Museum Hamburglocation not on record	1

25 institutions · 1 331 of 1 369 vouchered records shown · 38 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA6 detections

Where the DNA of Abacoproeces saltuum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

strukturreiches OffenlandHalbschattiger Pionierwald: Birke and Kiefer…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.2 °C 8.50–16.1

Seasonal swing summer↔winter25.1 °C

Max temp (day)17.5 °C 12.0–19.6

Min temp (night)7.00 °C 4.30–12.7

Precipitation59.3 mm/mo 44.2–73.2

Air humidity57.4 % 53.8–63.3

Moisture balance-36.4 mm/mo -74.7–-8.60

Vapour deficit681 Pa 469–757

Wind speed3.40 m/s 2.30–4.50

Cloud cover41.7 % 38.7–49.5

CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Abacoproeces saltuum

At a glance

Sources8 archives

Morphometry1

Predation2

Ecology8

At a glance

Record type1 628 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 25 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 628 records