Aaptos suberitoides

(Brøndsted, 1934) · species

image placeholder — illustration coming later

Animalia/Porifera/Demospongiae/Suberitida/Suberitidae/Aaptos

At a glance

Occurrence records54

Data sources10

Biological traits2

DNA specimens10

eDNA detections3

Sources10 archives

Databases and archives Aaptos suberitoides's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

OBISOcean Biodiversity Information System8 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics10 specimens↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS12 compounds

Occurrence & distributionGBIF · OBIS54 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD10 specimens

01Narrative

Aaptos suberitoides is a species of sea sponge belonging to the family Suberitidae. The species was described in 1934.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

03Chemical composition12 compounds

Compounds documented for Aaptos suberitoides across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Quinoline alkaloids2

Taraxerane triterpenoids2

Isoquinoline alkaloids2

Pyridine alkaloids2

Carboline alkaloids $ Imidazole alkaloids2

Documented compounds12 total

Tissue Source Quantified only

Compound	Amount	Source
(3S,4aR,6aR,6aS,8aR,12aR,14aS,14bR)-4,4,6a,6a,8a,11,11,14b-octamethyl-1,2,3,4a,5,6,8,9,10,12,12a,13,14,14a-tetradecahydropicen-3-ol	present	NPASS
(4aS,6aS,6bR,8aS,12aS,14aS,14bS)-2,2,4a,6b,9,9,12a,14a-octamethyl-3,4,6a,7,8,8a,10,11,12,13,14,14b-dodecahydro-1H-picen-5-one	present	NPASS
10,13-Dimethoxy-1,5,12-triazatetracyclo[6.6.2.04,16.011,15]hexadeca-2,4,6,8,10,12,15-heptaen-14-one	present	LOTUS
10-Methoxy-1,5,12-triazatetracyclo[6.5.2.04,15.011,14]pentadeca-2,4,6,8,10,12,14-heptaene	present	LOTUS
10-Methoxy-1,5,12-triazatetracyclo[6.6.2.04,16.011,15]hexadeca-2,4,6,8,10,12,15-heptaen-14-one	present	LOTUS
8,9,9-trimethoxy-9H-benzo[de][1,6]naphthyridine	present	LOTUS
8,9-Dimethoxy-1H-benzo(de)(1,6)naphthyridine	present	LOTUS
Isoaaptamine	present	LOTUS

05DNA & barcoding10 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aaptos suberitoides has left across the world's sequence archives.

At a glance

DNA specimens10

BINs1

Marker genes3

eDNA detections3

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P668 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 6 variable positions, in barcode order

3Tmostly conserved

102Tmostly conserved

105Cmostly conserved

240Cmostly conserved

591Amostly conserved

594Cmostly conserved

ATTGGTACTCTTTATTTATTATTTGGGGCTTTTGCCGGAATGATAGGGACAGCTTTTAGCATGTTAATAAGATTAGAGCTATCTGCCCCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Aaptos nudasame genus1.5%Rhizaxinella gadussame family3.5%Suberites diversicolorsame family3.7%Stylocordyla chupachupssame order4.1%Suberites aurantiacussame family4.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-3P★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type54 records

Wild obs. + sensor33

Museum / vouchered21

Range

Area of Occupancy AOO144 km²

Depth

0–200 m sunlit5

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 10 m · max 43 m · 5 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 9≤1 km 18≤10 km 2>10 km 2

31 georeferenced · 2 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 21 records without

Open the institutions mapphysical evidence21

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
WoRMS Editorial Boardlocation not on record	5
CASlocation not on record	4
Auckland, NZ	4

3 institutions · 13 of 21 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Aaptos suberitoides was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)