Aacanthocnema dobsoni

(Froggatt, 1903) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Triozidae/Aacanthocnema

At a glance

Occurrence records29

Data sources6

Biological traits0

DNA specimens7

eDNA detections8

Sources6 archives

Databases and archives Aacanthocnema dobsoni's data was compiled from.

GBIFGlobal Biodiversity Information Facility29 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF29 records

Environmental DNA1 datasets · 1 countries8 detections

DNA & barcodingBOLD7 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aacanthocnema dobsoni has left across the world's sequence archives.

At a glance

DNA specimens7

BINs1

Marker genes1

eDNA detections8

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus6 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Diversity (π)0.26%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 4 variable positions, in barcode order

112Tmostly conserved

259Cmostly conserved

415Gvariable

646Tmostly conserved

AACTTTATATTTCATTTTTGGTATTTGATCGGGATTAATAGGTTTATCTTTAAGCATAATTATTCGACTTGAACTAAGTCAATCATCTCC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Trioza erytreaesame family14.6%Trioza anthriscisame family16.7%Trioza psyllihabitussame family17.0%Necremnus tutaesame order17.6%Heteropsylla cubanasame order17.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_038132 ↗ · 13 protein · 22 tRNA · 2 rRNA

ND2COX1COX2ATP8ATP6COX3ND3ND5ND4ND4LND6CYTBND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type29 records

Wild obs. + sensor6

Museum / vouchered23

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 4≤1 km 1≤10 km 1

6 georeferenced

Open the mapobservation + sensor6

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 20

20 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Tasmanian Museum & Art Gallerylocation not on record	20

1 institutions · 20 of 23 vouchered records shown · 3 without an institution code

09Environmental DNA8 detections

Where the DNA of Aacanthocnema dobsoni was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.3 °C 14.7–20.2

Seasonal swing summer↔winter10.4 °C

Max temp (day)24.6 °C 20.1–26.0

Min temp (night)15.3 °C 10.3–16.1

Precipitation22.4 mm/mo 17.1–37.9

Air humidity56.0 % 55.1–58.4

Moisture balance-112 mm/mo -124–-46.7

Vapour deficit988 Pa 708–1,062

Wind speed4.00 m/s 2.60–4.10

Cloud cover16.5 % 14.4–19.0

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)